Translate this page into:
Antifungal Efficacy Of Essential Oils Against Wood-Degrading Fungi: A Strategy For Environmentally Sustainable Wood Preservation
* Corresponding author: Dr. Nahla Tharwat Elazab, Department of Biology, College of Sciences, Qassim University, Buraydah, Saudi Arabia. N.ELAZAB@qu.edu.sa
-
Received: ,
Accepted: ,
How to cite this article: Elazab NT, Altami MS. Antifungal Efficacy Of Essential Oils Against Wood-Degrading Fungi: A Strategy For Environmentally Sustainable Wood Preservation. J Qassim Univ Sci. doi: 10.25259/JQUS_38_2025.
Abstract
Objectives
Wood-degrading fungi are critical agents of biodeterioration, inflicting structural damage on woody products and resulting in substantial economic losses. The growing demand for eco-friendly antifungal methods has sparked interest in utilizing plant-derived essential oils from plants as renewable biological agents. This study aimed to assess the antifungal efficacy of certain essential oils against wood-decaying fungi.
Material and methods
Five fungal strains were isolated from rotten wood samples and identified morphologically. The efficacy of these isolated fungal strains to produce cellulases were tested and the highly cellulase producer was molecularly identified. The antifungal activity of various essential oils was assessed by measuring the percentage of growth inhibition. Wood pieces coated with the tested essential oils were artificially infected with the most cellulase producer for evaluating their protective potential and the enzyme activity was quantitatively determined.
Results
The isolated fungal strains were morphologically identified as Neurospora sp., Rhizopus sp., Alternaria sp., Penicillium sp., and Aspergillus sp. Among these strains, Neurospora sp. showed high performance in cellulase production and molecularly identified as Neurospora crassa. The results demonstrated that essential oils exhibited varying degrees of antifungal activity. Cinnamon oil demonstrated the highest level of antifungal efficacy against all isolated fungal strains. Licorice oil and garlic oil exhibited a notable antifungal effect on the growth of Neurospora crassa. In contrast, the inhibition of fungal growth in media supplemented with jojoba oil wasn’t significant. Artificial infection with the most aggressive wood rot fungus (Neurospora crassa) of wood pieces treated with essential oils showed significant limitation in their growth, particularly licorice and cinnamon oils. This effect is ensured by qualitative determination of cellulase production by Neurospora crassa.
Conclusion
These findings highlight the potential of essential oils as environmentally sustainable solutions to control wood-decaying fungus and mitigate wood deterioration. Their inhibitory effects on fungal growth and cellulolytic activity endorse their application as eco-friendly alternatives to conventional chemical methods.
Keywords
Cellulases
Essential oils
Fungi
Wood rot
INTRODUCTION
Wood is a renewable, organic material widely used in industries such as construction and furniture. However, the presence of organisms like fungi, bacteria, or termites in homes and buildings poses potential health risks. This problem is a major concern for homeowners, builders, contractors, and insurance companies who are involved in ensuring the safety and integrity of structures.[1] Carbohydrates (hemicelluloses and cellulose) and phenols (lignin) are the main organic compounds in wood. Wood comprises trace amounts of organic extractives, primarily low-molecular-weight molecules, alongside inorganic minerals such as calcium, potassium, magnesium, manganese, and silica.[2] Additionally, wood constituents include structural cell wall polysaccharides such as cellulose and hemicelluloses, lignin, and extractives that influence various material properties. Consequently, wood is vulnerable to various deteriorating agents, as they recognize these attacks as a vital source of energy.[3] Wood-decaying fungi are crucial organisms that decompose woody materials, playing a vital role in nutrient recycling and carbon cycling in forest ecosystems.[4]
Wood-decomposing fungi secrete a wide range of enzymes that act synergistically to break down the major constituents of wood, including cellulose, hemicellulose, and lignin. Studies indicated that cellulases play a key role in cellulose degradation. Cellulases encompass several enzyme classes, including endoglucanases, exoglucanases, and β-glucosidases, which work together to hydrolyze cellulose into smaller sugar units.[5] These enzymes cleave the glycosidic bonds within cellulose, releasing glucose as a readily available carbon source for the fungi. In addition to cellulose, hemicellulose is another major component of wood. Wood-decomposing fungi produce hemicellulases, such as xylanases and mannanases, which target the complex structure of hemicellulose. Xylanases specifically break down xylan, a major hemicellulosic polysaccharide, into xylose and other sugar units.[6] Mannanases, on the other hand, degrade mannans, another type of hemicellulosic polysaccharide, releasing mannose and other sugar derivatives. By secreting these hemicellulases, wood-decomposing fungi efficiently utilize the diverse range of substrates present in wood.
Various methods and techniques are used to prolong the lifespan of wood and wood products, including chemical processing and chemical treatments for wood protection against biocorrosion. However, these chemical substances can have detrimental impacts on the ecosystem.[7] Consequently, studies have aimed to explore natural alternatives that can act as environmentally friendly preservatives for wood and effectively inhibit fungal growth. Numerous natural substances, mainly of plant origin, including plant extracts, essential oils and their components, phenolic compounds, or alkaloids, have been investigated as potential antifungal agents in wood protection.[8]
Essential oils are volatile, extremely concentrated substances derived from various parts of specific plant species. Every essential oil possesses distinct energetic and therapeutic attributes. These volatile liquids are very intricate compounds exhibiting exceptionally potent and precise effects.[9] Essential oils are relatively widespread in the plant kingdom, some families being wealthy in such substances, both in number and quantity.[10] Pharmaceuticals, healthcare, food, and packaging applications extensively utilize essential oils and their derivatives for their antimicrobial properties.[11] Essential oils obtained from plants are complex mixtures of natural compounds, consisting of both polar and non-polar substances. These oils are well-known for their antiseptic and medicinal properties, and more and more people around the world are interested in how they could be used in research on how to protect wood in an environmentally friendly way. The number of essential oils with biological activity is constantly growing, making them a significant and diverse group of ingredients with potential use in eco-friendly wood preservation.[12] This work aims to investigate the potential of essential oils as a source of chemicals for wood preservative formulations. In vitro tests will be conducted to evaluate antifungal activity against various fungi that degrade wood. The findings will be open, affordable, and sustainable options for the extraction of antifungal components for application in preservatives for wood. The wood industry may be able to replace some of the more hazardous preservative ingredients with the antifungal components, which would lessen the preservatives’ detrimental effects on the environment. It would also discover a purpose for many wastes that are currently underutilized.
MATERIAL & METHODS
Culturing and isolation samples
Based on symptoms, rotten wood might be recognized. After an aseptic sample of wood was taken, it was transferred to the lab within hours for additional examination. The wood tissues were cut aseptically into several pieces (approximately 3 mm 3) under aseptic conditions. Each piece was submerged into 0.01% (w/v) mercuric chloride (HgCl₂) solution for 30 s, then rinsed three times with sterile water, and placed on potato dextrose agar (PDA) (BD DifcoTM) plates adjusted with 0.5% streptomycin, then incubated at 28°C for 2-7 days. The development of the cultivated fungi was monitored, and growing fungal colonies were relocated to a fresh sterile PDA medium for the purposes of isolation and purification.
Qualitative assay for cellulase production
Discs of the isolated fungal strains were cultured on petri plate containing medium of the following components (g l-1): NaCl (3.0), (NH4)2SO4 (1.0), KH2PO4 (0.5), K2HPO4 (0.5), MgSO4.7H2O (0.1), CaCl2. 2H2O (0.1), yeast extract (0.25), carboxymethylcellulose (10), and agar (20.0), then incubated at 26± 2°C. After 7 days of incubation, detection of cellulase activity was performed on the culture plate using iodine solution (1% iodine crystals and 2% potassium iodide), which, within 15 min, formed a bluish-black complex with cellulose or CMC, demarcating a clear zone around the colonies.[13]
Identification of fungal isolates
The pure fungal isolates were sub-cultured and grown for 7 days on Czapek Dox agar (CDA), and the isolated fungal species were morphologically identified.[14] Fungal isolates were identified according to microscopic observations and cultural characteristics.
According to the previous experiment, molecular identification was performed for the most productive fungal isolates of the cellulase enzyme. Total genomic DNA was extracted from the fungal isolate using a miniprep kit (ZYMO RESEARCH, California, USA) according to the manufacturer’s instructions. Genomic DNA was amplified using the fungal-specific primers: ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC).[15] Amplification was performed on a thermal cycler (SensoQuest, Göttingen, Germany) programmed as follows: 92°C for 5 min, followed by 35 cycles at 92°C for 30 s, 55°C for 30 s, and 72°C for 45 s, then a 5 min extension at 72°C. PCR products were electrophoresed at 85 V on 1% agarose gels, and the resulting bands were observed on a UV transilluminator (BIO-RAD, Hercules, CA, USA). The amplifications were sequenced at Macrogen Laboratories (Korea). Once the sequence was obtained, it was analyzed, and a nucleotide sequence similarity search was performed in GenBank using the Basic Local Alignment Search Tool (BLAST) from the National Center for Biotechnology Information (NCBI).
Antifungal test
Chemical preparation
Eight essential oils (licorice, jojoba, rosemary, garlic, peppermint, cinnamon, lavender, and lavender with tea tree oil) were offered for sale at a local market in Buraydah City, KSA. These essential oils are packed in a 10 mL dark glass bottle. Certain oils were selected without regard to their effectiveness, whereas others were chosen based on recent findings.[16]
Antifungal activities on mycelial growth
Using a sterilized cork borer, a fungal disc from previously cultivated fungal strains was taken and inoculated into the center of the petri dish with the growth media containing the tested essential oils and the control media. The petri dishes were subsequently wrapped with parafilm and maintained in an incubator at 26 ± 2°C. The growth diameter of the fungal colony was assessed daily until the fungus in the control samples completely covered the petri dish, which occurred between 8 and 14 days, depending on the fungal strain and replicates. The mycelial growth inhibition (%) of the tested essential oils was measured following the formula used by.[17]
Where: dcontrol indicates the mean diameter of the mycelial growth of the control (without essential oils), dtreatment indicates the mean diameter of the mycelial growth of treated fungal species (in the presence of essential oils).
In vitro examination of essential oils and plant extract efficiency as wood preservatives
This experiment was conducted as follows: about 2 g of small wood pieces were soaked in 2mL of each tested essential oil for 15 min, then transferred to a conical Erlenmeyer flask (250mL). To each flask, 3 mL of dist. H2O was added to maintain the humidity necessary for fungal growth. The flasks were autoclaved at 121°C for 25 min, and then each flask was inoculated with two discs of the most cellulase-producing strain. The positive control (wood sample soaked in 2 mL of distilled H2O) was inoculated with the fungal isolate, while the negative control was uninoculated. The flasks were incubated for 7 days at 26± 2°C.
Effect of the tested volatile oil on cellulolytic enzyme activity
For the previous experiment, according to the modified method of [18] enzymes were extracted by adding 5 mL of cold 0.05 M acetate buffer (pH 4.8) to the substrate flask. The homogenate was filtered through muslin cloth, then centrifuged at 5000 rpm and 4°C for 15 min. The supernatant was analyzed for carboxylmethyl cellulase (CMCase).
Carboxymethyl cellulase activity (CMCase) was measured as described.[19] The reaction mixture comprised 0.5 mL enzyme extract, 0.5 mL of 1% carboxymethyl cellulose in 0.05 M sodium acetate buffer (pH 5.0), and 1 mL DNSA, and was incubated at 50°C in a water bath for 20 minutes. The liberated glucose due to enzyme activity was evaluated by DNSA, measured at 540 nm using a spectrophotometer.
Statistical analysis
The data was analyzed statistically using SPSS (version 22.0, 2013, IBM Corp., Armonk, NY, USA). The data obtained from different parameters were assessed for normality and analyzed using ANOVA. The comparison between means of the data was carried out using Tukey’s HSD test at P values of ≤0.05.
RESULTS AND DISCUSSION
Isolation and qualitative evaluation of cellulase production of isolated fungal strains
Wood deterioration is a significant concern, necessitating the isolation and identification of the fungus responsible. Results show that five fungal strains were obtained from different rotten wood samples. These isolates were qualitatively examined for their ability to produce cellulase enzymes. The results show variations in the production of extracellular cellulase enzymes by the isolated fungal strains. Isolate No. 1 showed the highest enzyme production among the isolates. While Isolate No. 4 was recorded as the minimum enzyme producer. Isolate No. 2 and Isolate No. 5 show intermediate cellulase enzyme production as illustrated in Figure 1.

- The cellulase enzyme activities of isolated fungal strains. Vertical bars represent standard error (± SD).
Identification of fungal isolates
As presented in Table 1 and Figure 2, five fungal isolates, obtained from rotten wood, were morphologically identified. Most of these isolates belong to Ascomycota. Among these isolates, molecular identification of the highly cellulase-producing isolate, as reported in the previous investigation, was carried out. The BLAST and phylogenetic analyses showed that the isolate was related to Neurospora crassa, as shown in the phylogenetic tree [Figure 3]. The ITS sequence obtained was submitted to NCBI GenBank under Accession No. PX620420
| Fungal isolates | Name | Family |
|---|---|---|
| Isolate 1 | Neurospora sp. | Sordariaceae |
| Isolate 2 | Rhizopus sp. | Mucoraceae |
| Isolate 3 | Alternaria sp. | Pleosporaceae |
| Isolate 4 | Penicillium sp. | Aspergillaceae |
| Isolate 5 | Aspergillus sp. | Aspergillaceae |

- Microscopic images of isolated fungal strains: (a) Isolate 1, (b) Isolate 2, (c) Isolate 3, (d) Isolate 4 and (e) Isolate 5.

- Phylogenetic tree based on ITS sequences of isolated fungal strains and fungal ITS sequences from the GenBank.
Antifungal activities of the tested essential oils
Different essential oils were evaluated for their ability to suppress the growth of isolated fungal strains, and the results revealed significant variations in their effects, suggesting that each oil had a unique degree of activity under the experimental conditions. Data presented in Table 2 shows that, among the tested essential oils, cinnamon oil recorded the most efficient antifungal activity against all isolated fungal strains. Licorice oil and garlic oil demonstrated significant antifungal effects on Neurospora sp., with 99.04% and 92.4%, respectively. In contrast, the fungal growth inhibition in media amended with jojoba oil wasn’t significant.
| Tested biocontrol agents | Growth inhibition (%) | ||||
|---|---|---|---|---|---|
| Neurospora sp. | Rhizopus sp. | Alternaria sp. | Penicillium sp. | Aspergillus sp. | |
| Licorice oil | 99.04±1.61a | 29.00±2.22f | 70.00±0.95d | 68.46±1.91e | 52.85±1.82g |
| Jojoba oil | 10.16±0.93h | 7.14±1.15g | 20.32±1.52g | 14.36±1.32h | 9.42±2.67h |
| Rosemary oil | 66.91±1.37f | 89.23±2.17b | 90.87±2.43bc | 84.95±3.09c | 88.27±1.92b |
| Garlic oil | 92.40±2.72b | 3.50±1.675h | 30.24±1.56f | 60.00±1.48f | 74.18±1.52d |
| Peppermint oil | 81.74±1.91d | 74.37±3.07e | 97.00±2.73a | 74.63±2.35d | 64.64±2.34f |
| Cinnamon oil | 98.28±1.08a | 100.0±4.82a | 95.76±1.13a | 97.45±1.77a | 100.00±1.26a |
| Lavender oil | 84.53±1.64c | 80.18±3.57d | 87.94±1.36c | 83.95±1.21c | 79.55±2.93c |
| Lavender oil+ tea tree oil | 93.21±2.16b | 85.54±2.75c | 92.06±1.51b | 90.86±1.09b | 87.56±1.77b |
In each column, values followed by the same letter are not significantly different according to Tukey’s HSD test (p ≤ 0.05); each value represents the mean of three replicates ± SD.
Evaluation of the effect of essential oils on fungal growth and cellulase activity
level of cellulase
Chemical preservatives used in wood have negative environmental effects. Therefore, attention turned to the availability of safer alternatives, so this experiment was conducted to determine the possibility of using these alternatives as promising materials for preserving wood from decaying by Neurospora sp. due to their virulence toward wood decay. As shown in Figure 4, wood samples treated with the tested essential oils weren’t suitable for the growth of Neurospora sp. compared with the +ve control.

- The effect of wood treatment with the biocontrol agents on growth of Neurospora sp: (a) Licorice oil, (b) Jojoba oil, (c) Rosemary oil, (d) Garlic oil, (e) Peppermint oil, (f) Cinnamon oil, (g) Lavender oil, (h) Lavender + tea tree oils, (i) negative control, and (j) positive control.
As shown in Table 3 and Figure 5, among all tested oils, compared with the control condition, the presence of licorice oil and cinnamon oil in the media significantly reduces CMCase production by Neurospora sp. Reaching activity 0.13 and 0.28 IUg-1, respectively. Also, garlic oil has a relatively similar effect on enzyme production. The remaining tested oils have a moderate impact on enzyme activity.
| Tested biocontrol agents | CMCase activity (IU g-1) |
|---|---|
| control | 3.12 ±0.006a |
| Licorice oil | 0.13 ± 0.008h |
| Jojoba oil | 2.16 ± 0.084c |
| Rosemary oil | 1.81 ± 0.016 d |
| Garlic oil | 0.94 ± 0.053f |
| Peppermint oil | 2.34 ± 0.029b |
| Cinnamon oil | 0.28 ± 0.012g |
| Lavender oil | 1.81 ± 0.042d |
| Lavender oil + tea tree oil | 1.57 ± 0.076e |
In each column, values followed by the same letter are not significantly different according to Tukey’s HSD test (p ≤ 0.05), each value represents the mean of three replicates ± SD.

- Effect of wood treatment with the biocontrol agents on CMCase production by Neurospora sp.
DISCUSSION
The search for novel wood preservatives has been encouraged by the growing resistance of fungi to chemical preservatives, heightened societal environmental consciousness, and more stringent chemical laws governing conventional wood preservatives.[20] The initial stage of a program to investigate various biological resources involves in vitro analysis, which identifies the most bioactive products and establishes their working concentration range. This work successfully isolated five fungal strains from naturally deteriorated wood, which were subsequently identified based on morphological and cultural characteristics. Most of these isolates belong to Ascomycota. These results are in accordance with those of.[21] The diversity of isolates obtained in this investigation aligns with previous research highlighting the rich mycobiota associated with the degradation of hardwood substrates.
Wood-rot fungi play a crucial role in nutrient and carbon cycling in forest ecosystems because they are primarily responsible for breaking down lignocellulose, one of the most resistant polymers in wood.[22] For this purpose, the present study evaluated the efficacy of the isolated fungal strain for cellulase production, and the results showed that Neurospora sp. was superior to its peers. These findings are corroborated by, which asserts that Sordariomycetes are proficient lignocellulose decomposers capable of generating substantial quantities of lignocellulose-degrading enzymes due to possessing genes that degrade lignocellulose.[23]
Plant derivatives, such as essential oils and extracts, obtained from various plant materials, exhibit biological effects. Therefore, chemical compounds and plant-derived substances may be of interest for the development of new, environmentally friendly wood preservatives. Moreover, a significant benefit of plant-derived products is their abundant diversity and accessibility, as well as the ability to extract bioactive compounds from plants. Research demonstrates that several plant-derived chemicals have been evaluated for wood preservation, including essential oils, tannins, terpenes, plant extracts, phenolic compounds, alkaloids, plant oils, and resins.[24-26]
Before analyzing target locations or mechanisms of action, the antifungal activity of essential oils must be demonstrated.[27] This method is accurate, as, to the best of our knowledge, essential oils’ activity ranged widely depending on the target pathogen, from extremely effective to ineffectual and from general to specific efficacy. In this study, several essential oils were used, including cinnamon oil, which has powerful antifungal activity.[28] Showed similar results by testing cinnamon volatile oils against six fungi that caused post-harvest decay of grapes. This decent efficiency is because E-cinnamaldehyde and cinnamyl acetate are the main constituents of cinnamon oil. In Taiwan, researchers evaluated the in vitro antifungal activity of cinnamon leaf EO against fungi that cause wood decay. According to this study, at 50–100 ppm, this EO and its primary ingredient, cinnamon aldehyde, had potent antifungal action.[29] Our results are consistent with the study, which reported that cinnamon essential oils possess broad-spectrum antifungal activity.[16]
Lavender oil exhibited both fungistatic and fungicidal activities. The primary constituents of lavender oil, linalool and linalyl acetate, accounted for approximately 75% of the oil. It was found that linalool was responsible for the fungicidal activity, while linalyl acetate inhibited germ tube formation.[30] Likewise, rosemary oil exhibited promising antifungal properties. It contains bioactive compounds such as 1,8-cineole, which possess antifungal characteristics. These compounds have been reported to disrupt fungal cell membranes and inhibit fungal enzyme activity, thereby inhibiting fungal growth.[31]
Peppermint oil also displayed significant antifungal effects. The main active component in peppermint oil, menthol, exhibits broad-spectrum antimicrobial activity, including antifungal properties. Menthol disrupts fungal cell membranes, resulting in fungal death or growth inhibition.[32] Furthermore, tea tree oil and its constituents were found to alter the permeability and fluidity of fungal membranes, thereby affecting membrane properties and disrupting membrane-related processes.[12] Garlic oil also showed significant antifungal activity, which may be due to its richness in organic sulfur compounds. Moreover, it has various medicinal properties, including antioxidant, antifungal, antidiabetic, and anti-inflammatory.[33]
Many plants, especially those in the Lamiaceae family, such as Rosmarinus officinalis L. (rosemary), are known for their antifungal activity, particularly in their essential oils and leaves.[34] Studies indicate that rosemary essential oil yields vary depending on plant species, the collection area’s ecology, whether the plant is cultivated or spontaneous, and the extraction method used.[35] Antifungal activity of this oil is due to the chemical structure, which includes many important compounds, such as bornyl acetate, rosmarinic acid, α-pinene, camphor, carnosol, carnosic acid, rosmarinic acid, rosmanol, and rosemaridiphenol.[36,37] These active compounds facilitate the permeation of the fungal cell wall and penetrate the lipid bilayer, rendering the cell membrane permeable, resulting in cytoplasmic leakage, cell lysis, cell death, or prevention of sporulation and germination.[38]
Previous studies reported that rosemary oil exhibited relatively weak to moderate antifungal activity against various fungal species, including Penicillium sp., Aspergillus sp., Fusarium sp., and Trichoderma sp.[39] Antimicrobial essential oils disrupt membrane permeability and osmotic equilibrium and depend on their hydrophobicity and partitioning into microbial membranes, resulting in structural and functional damage to microbes.[40]
The present study demonstrated that the tested essential oil significantly inhibited cellulase activity of the most potent wood-decomposing isolate, identified as Neurospora crassa, isolated from rotted wood samples. In particular, the presence of licorice and cinnamon oils significantly reduced the extracellular cellulase activity, suggesting that these oils can disrupt the cellulolytic mechanisms of this fungal strain.[41,42] Reported that cinnamon and licorice oils have an extensive antimicrobial effect, and this adversely influences fungal metabolism and enzyme production. According to a recent study that emphasized the sensitivity of cellulase expression to environmental and metabolic stress, our findings indicate that essential oils may reduce cellulase production in Neurospora crassa, either directly by inhibiting enzyme secretion or indirectly by interfering with signaling pathways.[43]
CONCLUSION
Recent studies have significantly advanced our knowledge of wood-decaying fungi, unveiling their enzymatic capabilities, ecological significance, and evolutionary relationships. The diverse enzymatic machinery employed by wood-decaying fungi highlights their remarkable adaptability and efficiency in wood-decay processes. Understanding the ecological roles and classification of wood-decaying fungi is crucial for forest management and conservation efforts, as they play a fundamental role in nutrient cycling and carbon dynamics. Ongoing research in this field will continue to deepen our understanding of these fascinating organisms and further unravel the intricate mechanisms of wood decay.
Ethical approval
This study did not require ethical approval as it did not involve human participants, animals, or sensitive personal data.
Declaration of patient consent
No declaration of patient consent was required for this study.
Financial support and sponsorship
Nil.
Conflicts of interest
The author declare no conflicts of interest related to this research study.
Use of artificial intelligence (AI)-assisted technology for manuscript preparation
The author declare that no artificial intelligence tools were used in the preparation of this study.
References
- Antifungal agents in wood protection-A review. Molecules. 2022;27:6392.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Microchamber extraction and analytical pyrolysis to explore volatile organic compounds from compression-cooking wood materials obtained under different conditions. Molecules. 2022;27:8260.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Identification and control of wood-deteriorating fungi. Arq Inst Biol. 2020;87
- [CrossRef] [Google Scholar]
- Characterizing the assemblage of wood-decay fungi in the forests of northwest arkansas. J Fungi (Basel). 2021;7:309.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Forest microbiome: Diversity, complexity and dynamics. FEMS Microbiol Rev. 2017;41:109-30.
- [CrossRef] [PubMed] [Google Scholar]
- Ligninolytic enzymes and its mechanisms for degradation of lignocellulosic waste in environment. Heliyon. 2020;6:e03170.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Evaluation of the fungicidal properties of essential oils from leptospermum scoparium and azadirachta indica in relation to selected fungi causing wood decay. Annals of WULS - SGGWForestry and Wood Technology. 2020;110:118-25.
- [Google Scholar]
- Natural compounds for wood protection against fungi-A review. Molecules. 2020;25:3538.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Assessment of immunogenicity of alginate microparticle containing Brucella melitensis 16M oligo polysaccharide tetanus toxoid conjugate in mouse. bjbabe. 2017;8:83-92.
- [CrossRef] [Google Scholar]
- Adaptability and stability of white lupin cultivars. Bjbabe. 2018;IX:65-76.
- [CrossRef] [Google Scholar]
- The significance of essential oils and their antifungal properties in the food industry: A systematic review. Heliyon. 2023;9:e21386.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Essential oils and antifungal activity. Pharmaceuticals (Basel). 2017;10:86.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Cellulase Producing Bacteria from the Wood-Yards on Kallai River Bank. J Adv Microbiol. 2013;3:326-32.
- [CrossRef] [Google Scholar]
- Compendium of Soil Fungi. Vol Vol. 1-2. London: Academic Press; 1980.
- Amplification and direct sequencing of fungal ribosomal rna genes for phylogenetics. In: PCR protocols PCR protocols. Elsevier; 1990. p. :315-22.
- [Google Scholar]
- Antifungal activity of thirty essential oils to control pathogenic fungi of post-harvest decay. Antibiotics (Basel). 2023;13:28.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- In vitro inhibition of mycelial growth of several phytopathogenic fungi by soluble potassium silicate. South Afr J Plant Soil. 2006;23:169-72.
- [Google Scholar]
- Production of cellulases from Aspergillus niger NS-2 in solid state fermentation on agricultural and kitchen waste residues. Waste Manag. 2012;32:1341-6.
- [CrossRef] [PubMed] [Google Scholar]
- Isolation of cellulolytic fungi and their degradation on cellulosic agricultural wastes. J Acad Ind Res.. 2014;2:458-63.
- [Google Scholar]
- Antifungal activity of several vegetable origin household waste extracts against wood-decaying fungi in vitro. Waste Biomass Valor. 2021;12:1237-41.
- [Google Scholar]
- Diversity of wood-inhabiting agaricomycotina on wood of different size classes in riparian forests of Uruguay. Mycoscience. 2019;60:156-64.
- [Google Scholar]
- lignocellulolytic enzyme production from wood rot fungi collected in Chiapas, Mexico, and their growth on lignocellulosic material. J Fungi (Basel). 2021;7:450.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Effects of mixed-species litter on bacterial and fungal lignocellulose degradation functions during litter decomposition. Soil Biol Biochem. 2020;141:107690.
- [CrossRef] [Google Scholar]
- Efficacy of linseed- and tung-oil-treated wood against wood-decay fungi and water uptake. Int Biodeterioration & Biodegradation. 2013;85:223-7.
- [CrossRef] [PubMed] [Google Scholar]
- A comparison between some wood bark extracts: antifungal activity. Kastamonu University Journal of Forestry Faculty.. 2017;17:502-8.
- [Google Scholar]
- Natural bio-based products for wood coating and protection against degradation: A Review. BioRes. 2019;14:4873-901.
- [Google Scholar]
- A review of the methods used to determine the target site or the mechanism of action of essential oils and their components against fungi. SN Appl Sci.. 2021;3:44.
- [Google Scholar]
- Antifungal activity of clove and cinnamon oil and their synergistic against post-harvest decay fungi of grape in vitro. Agriculture Nat Resources. 2008;42:169-74.
- [Google Scholar]
- Antifungal activities of essential oils and their constituents from indigenous cinnamon (Cinnamomum osmophloeum) leaves against wood decay fungi. Bioresour Technol. 2005;96:813-8.
- [CrossRef] [PubMed] [Google Scholar]
- Antifungal activity of Lavandula angustifolia essential oil against Candida albicans yeast and mycelial form. Med Mycol.. 2005;43:391-6.
- [CrossRef] [PubMed] [Google Scholar]
- Efficacy and antifungal mechanism of rosemary essential oil against colletotrichum gloeosporioides. Forests. 2024;15:377.
- [CrossRef] [Google Scholar]
- Antibacterial and antifungal properties of essential oils. Curr Med Chem. 2003;10:813-29.
- [CrossRef] [PubMed] [Google Scholar]
- The ethnobotanical, bioactive compounds, pharmacological activities and toxicological evaluation of garlic (Allium sativum): A review. Pharmacological Res - Modern Chin Med. 2023;8:100273.
- [CrossRef] [Google Scholar]
- Purification of rosmarinic acid from rosemary extract and the evaluation of the antibacterial and antioxidant effects of rosmarinic acid and its derivatives. Separations. 2025;12:294.
- [CrossRef] [Google Scholar]
- Inhibitory effect of some spice essential oils on penicillium digitatum causing post-harvest rot in citrus. Grasas aceites. 2000;51:237-40.
- [Google Scholar]
- Effects of dietary rosemary extract supplementation on growth performance, nutrient digestibility, antioxidant capacity, intestinal morphology, and microbiota of weaning pigs. J Anim Sci. 2021;99:skab237.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Phytochemical analysis and antioxidant and antifungal activities of powders, methanol extracts, and essential oils from rosmarinus officinalis L. and Thymus ciliatus Desf. Benth. Int J Mol Sci. 2024;25:7989.
- [Google Scholar]
- Carnosic acid and carnosol, two major antioxidants of rosemary, act through different mechanisms. Plant Physiol. 2017;175:1381-94.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Essential oils as an antifungal alternative to control several species of fungi isolated from Musa paradisiaca: Part III. Microorganisms. 2025;13:1663.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Plant essential oils as food preservatives to control moulds, mycotoxin contamination and oxidative deterioration of agri-food commodities – Potentials and challenges. Food Control. 2015;47:381-9.
- [Google Scholar]
- Essential oils as an antifungal alternative for the control of various species of fungi isolated from Musa paradisiaca: Part I. Microorganisms. 2025;13:1827.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Biodegradable carboxymethyl cellulose–polyvinyl alcohol composite incorporated with GlycyrrhizaGlabra L. essential oil: Physicochemical and antibacterial features. Food Science & Nutrition. 2021;9:4974-85.
- [PubMed] [Google Scholar]
- Intracellular nitric oxide and camp are involved in cellulolytic enzyme production in neurospora crassa. Int J Mol Sci. 2023;24:4503.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]

